Clark Kent Connor Bitcoin Dog - Mix of St. Bernard, Corgi, Dachshund, Shiba Inu, Grey Wolf, Boxer, Labrador, Pitbull terrier and Rottweiler
Clark Kent Connor
  • Purity 3%
  • Age 11 months
  • Racing Exp 0
  • St. Bernard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I really dislike stinky flea collars. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGAGGAGTAAGCCCCAACCCAAGCTCCTGACAC
T
G
A
G
G
A
G
T
A
A
G
C
C
C
C
A
A
C
C
C
A
A
G
C
T
C
C
T
G
A
C
A
C
Genes: BAEOLG5ONBH

Composition

St. Bernard
18%
Corgi
18%
Dachshund
9%
Shiba Inu
9%
Grey Wolf
9%
Boxer
9%
Labrador
9%
Pitbull terrier
9%
Rottweiler
9%

Current Energy

Vitality -50 points
Lunar Effect -2 points

Traits Breakdown

Body St. Bernard
Tail Dachshund
Legs Shiba Inu
Front Legs Corgi
Head Grey Wolf
Ears Boxer
Snout Labrador
Mouth Corgi
Nose Pitbull terrier
Eyes St. Bernard
Color Rottweiler

Parents

No Children

Gift