Courage Chaz Crypto Game Dog - Mix of Grey Wolf, Golder Retriever, Corgi, German Shepard, French Bulldog, Maltese, Pug and Pitbull terrier
Courage Chaz
  • Purity 4%
  • Age 5 months
  • Racing Exp 0
  • Grey Wolf 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

I'm Courage Chaz. How goes it? I like to respond to sad puppy eyes with sad puppy eyes of my own. People food disagrees with me. Whew! You can tell. I live life by my favorite quote "Every dog has it's day", but every day is my day! I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCACCCAGAAGCCCCCGAAGCACCGAATCCAGA
T
C
A
C
C
C
A
G
A
A
G
C
C
C
C
C
G
A
A
G
C
A
C
C
G
A
A
T
C
C
A
G
A
Genes: 7L8OL9OK2N8

Composition

Grey Wolf
18%
Golder Retriever
18%
Corgi
18%
German Shepard
9%
French Bulldog
9%
Maltese
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality -31 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Grey Wolf
Legs Golder Retriever
Front Legs Corgi
Head Grey Wolf
Ears French Bulldog
Snout Corgi
Mouth Maltese
Nose Pug
Eyes Pitbull terrier
Color Golder Retriever

Parents

No Children

Gift