Jolie Jiminy Litecoin Dog - Mix of Border Collie, German Shepard, Rottweiler, Boxer, Maltese, St. Bernard, Poodle and French Bulldog
Jolie Jiminy
  • Purity 4%
  • Age 13 months
  • Racing Exp 0
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I enjoy mixing it up once in a while by visiting different dog parks. I don't like to be ignored. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Looking for that special tail wag.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAACTCATACACCTGATCACACGACCGACAC
T
A
C
A
A
C
T
C
A
T
A
C
A
C
C
T
G
A
T
C
A
C
A
C
G
A
C
C
G
A
C
A
C
Genes: JG7JKB7HI9H

Composition

Border Collie
18%
German Shepard
18%
Rottweiler
18%
Boxer
9%
Maltese
9%
St. Bernard
9%
Poodle
9%
French Bulldog
9%

Current Energy

Vitality -14 points
Lunar Effect +2 points

Traits Breakdown

Body Border Collie
Tail Boxer
Legs German Shepard
Front Legs Border Collie
Head Maltese
Ears St. Bernard
Snout German Shepard
Mouth Rottweiler
Nose Poodle
Eyes French Bulldog
Color Rottweiler

Parents

No Children

Gift