Bernard Basket Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Golder Retriever, Dachshund, St. Bernard, Labrador BK, Schnauzer, Husky, Boxer and French Bulldog
Bernard Basket
  • Purity 5%
  • Age 5 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hi, I'm Bernard Basket. I work in The Virtual Machine. As a perfectionist, I have to find just the right 'spot'. I'm going kill that damn Nyan Cat if I can catch it. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I want someone who can show me a good time; I'll do the same for you.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGATTATTATGAGCAAGAATAACAAGAAACCGA
G
G
A
T
T
A
T
T
A
T
G
A
G
C
A
A
G
A
A
T
A
A
C
A
A
G
A
A
A
C
C
G
A
Genes: AFFB68C48G9

Composition

Yorkshire Terrier
18%
Golder Retriever
18%
Dachshund
9%
St. Bernard
9%
Labrador BK
9%
Schnauzer
9%
Husky
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -50 points
Lunar Effect +12 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Labrador BK
Ears Golder Retriever
Snout Schnauzer
Mouth Husky
Nose Golder Retriever
Eyes Boxer
Color French Bulldog

Parents

No Children

Gift