Barkley Brando Crypto Dog - Mix of Boxer, Golder Retriever, Pug, Labrador BK, Border Collie, Yorkshire Terrier, Labrador, Maltese and Rottweiler
Barkley Brando
  • Purity 3%
  • Age 4 months
  • Racing Exp 0
  • Boxer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm not a fan of sleeping on the floor. This body was made for cuddles! I'll outrun you for the ball if I can...that's just how I roll. You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AACGAAAACAGAGCATACTTAAGACCAACCCAC
A
A
C
G
A
A
A
A
C
A
G
A
G
C
A
T
A
C
T
T
A
A
G
A
C
C
A
A
C
C
C
A
C
Genes: G2G86JF85KH

Composition

Boxer
18%
Golder Retriever
18%
Pug
9%
Labrador BK
9%
Border Collie
9%
Yorkshire Terrier
9%
Labrador
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Pug
Legs Boxer
Front Legs Golder Retriever
Head Labrador BK
Ears Border Collie
Snout Yorkshire Terrier
Mouth Golder Retriever
Nose Labrador
Eyes Maltese
Color Rottweiler

Parents

No Children

Gift