Fang Fuzzy Bitcoin Dog - Mix of Pitbull terrier, Maltese, Rottweiler, Poodle, Boxer, Labrador, Pug, French Bulldog, Beagle and Schnauzer
Fang Fuzzy
  • Purity 1%
  • Age 11 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Hola! My name is Fang Fuzzy. I like exploring off leash best. I hate never catching that damn rabbit in my dreams. My favorite sport is catching treats my human throws! My female human wears crotchless undies, but she doesn't like the ones I make for her!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACCCACGACTCCAACCCATCCGAACGACTAATA
A
C
C
C
A
C
G
A
C
T
C
C
A
A
C
C
C
A
T
C
C
G
A
A
C
G
A
C
T
A
A
T
A
Genes: KHING5N29DC

Composition

Pitbull terrier
18%
Maltese
9%
Rottweiler
9%
Poodle
9%
Boxer
9%
Labrador
9%
Pug
9%
French Bulldog
9%
Beagle
9%
Schnauzer
9%

Current Energy

Vitality -60 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs Poodle
Front Legs Pitbull terrier
Head Boxer
Ears Labrador
Snout Pitbull terrier
Mouth Pug
Nose French Bulldog
Eyes Beagle
Color Schnauzer

Parents

No Children

Gift