Roland Ringo Crypto Game Dog - Mix of Border Collie, Dachshund, Yorkshire Terrier, Corgi, St. Bernard, Shiba Inu, Grey Wolf and Beagle
Roland Ringo
  • Purity 6%
  • Age 15 months
  • Racing Exp 0
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Lazy

Achievements

None

Bio

I'm always up for some puppy action, is that wrong? I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I love unconditionally. If you are looking for companionship without commitment, so am I.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCTACTGAGGAGTAGGATACCCCCTATTATTA
A
G
C
T
A
C
T
G
A
G
G
A
G
T
A
G
G
A
T
A
C
C
C
C
C
T
A
T
T
A
T
T
A
Genes: OJBAEAJLDFF

Composition

Border Collie
18%
Dachshund
18%
Yorkshire Terrier
18%
Corgi
9%
St. Bernard
9%
Shiba Inu
9%
Grey Wolf
9%
Beagle
9%

Current Energy

Vitality -35 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Border Collie
Legs St. Bernard
Front Legs Dachshund
Head Shiba Inu
Ears Dachshund
Snout Border Collie
Mouth Grey Wolf
Nose Beagle
Eyes Yorkshire Terrier
Color Yorkshire Terrier

Parents

No Children

Gift