Stormy Slick Bitcoin Game Dog - Mix of St. Bernard, Labrador, Schnauzer, Rottweiler, Corgi, Pitbull terrier, Labrador BK and Shiba Inu
Stormy Slick
  • Purity 8%
  • Age 15 months
  • Racing Exp 0
  • St. Bernard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Neutral & Lazy

Achievements

None

Bio

I'm Stormy Slick. What do they call you? I live in cyberspace. I hate never catching that damn rabbit in my dreams. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TGAATACACCCATGATGAAGCTCCGCAGTACCA
T
G
A
A
T
A
C
A
C
C
C
A
T
G
A
T
G
A
A
G
C
T
C
C
G
C
A
G
T
A
C
C
A
Genes: BCH5BBON6E5

Composition

St. Bernard
27%
Labrador
18%
Schnauzer
9%
Rottweiler
9%
Corgi
9%
Pitbull terrier
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality -25 points
Lunar Effect +12 points

Traits Breakdown

Body St. Bernard
Tail Schnauzer
Legs Rottweiler
Front Legs Labrador
Head St. Bernard
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Labrador BK
Eyes Shiba Inu
Color Labrador

Parents

No Children

Gift