Taffy Taylor Crypto Dog - Mix of Corgi, St. Bernard and French Bulldog
Taffy Taylor
  • Purity 44%
  • Age 7 months
  • Racing Exp 1
  • Corgi 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I live behind a firewall in the Machine. I'm going kill that damn Nyan Cat if I can catch it. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time16.15 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGCAGCAGCAGCAGCTGATGATGATGATGACGA
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
C
G
A
Genes: OOOOOBBBBB9

Composition

Corgi
45%
St. Bernard
45%
French Bulldog
9%

Current Energy

Vitality -40 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color French Bulldog