Comet Carrera Litecoin Dog - Mix of Grey Wolf, Beagle, Corgi, Schnauzer, St. Bernard, Pug, Golder Retriever and Labrador BK
Comet Carrera
  • Purity 9%
  • Age 5 months
  • Racing Exp 9
  • Grey Wolf 36%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

How YOU doin'? Comet Carrera here. I hate it when other dogs pee in my yard! IT'S MY YARD!! Hope you like the smell of wet fur, because I'll jump into any water I see! My humans say I bark too much, but I have a lot to say! I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go.

Racing Stats

Ran 3 races
  • 0 1 0
 Best Time15.50 sec
No rank  RacingĀ *** LTC
33.3 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAAGCATATGACCCGAACCCAGACCCGCACCC
C
T
A
A
G
C
A
T
A
T
G
A
C
C
C
G
A
A
C
C
C
A
G
A
C
C
C
G
C
A
C
C
C
Genes: DOCBL2L8L6L

Composition

Grey Wolf
36%
Beagle
9%
Corgi
9%
Schnauzer
9%
St. Bernard
9%
Pug
9%
Golder Retriever
9%
Labrador BK
9%

Current Energy

Vitality -55 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Corgi
Legs Schnauzer
Front Legs St. Bernard
Head Grey Wolf
Ears Pug
Snout Grey Wolf
Mouth Golder Retriever
Nose Grey Wolf
Eyes Labrador BK
Color Grey Wolf