Sugar Sven Crypto Game Dog - Mix of German Shepard, French Bulldog, Labrador BK, Dachshund, Golder Retriever, Yorkshire Terrier, Grey Wolf and Shiba Inu
Sugar Sven
  • Purity 8%
  • Age 7 months
  • Racing Exp 17
  • German Shepard 27%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 5 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

The smell of fresh manure to roll in makes me wild. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.

Racing Stats

Ran 5 races
  • 1 0 1
 Best Time14.45 sec
No rank  RacingĀ *** LTC
40.0 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CGAGCAGGAAGATCACGATTATCATCACCCGTA
C
G
A
G
C
A
G
G
A
A
G
A
T
C
A
C
G
A
T
T
A
T
C
A
T
C
A
C
C
C
G
T
A
Genes: 96A879F77LE

Composition

German Shepard
27%
French Bulldog
18%
Labrador BK
9%
Dachshund
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality -41 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Labrador BK
Legs Dachshund
Front Legs Golder Retriever
Head German Shepard
Ears French Bulldog
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes Grey Wolf
Color Shiba Inu