Guido Gus Bitcoin Dog - Mix of German Shepard, Pug, Beagle, Grey Wolf, Yorkshire Terrier, Pitbull terrier, Boxer, Maltese, Labrador, Labrador BK and Rottweiler
Guido Gus
  • Purity 0%
  • Age 16 months
  • Racing Exp 18
  • Mixed-breed
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 6 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

Guido Gus here. Wanna play? I hate it when my human runs out of poop-bags. How embarrassing! Those flying monkeys in the Wizard of Oz still scare me! I enjoy exploration and am game for anything doggy-style. As long as we are headed in the same direction, I say we try hanging out for a while.

Racing Stats

Ran 6 races
  • 0 2 0
 Best Time15.27 sec
No rank  RacingĀ *** LTC
33.3 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAGAACTACCCTTATCCAACACCCCAGCACAC
T
C
A
G
A
A
C
T
A
C
C
C
T
T
A
T
C
C
A
A
C
A
C
C
C
C
A
G
C
A
C
A
C
Genes: 72DLFNGK56H

Composition

German Shepard
9%
Pug
9%
Beagle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Boxer
9%
Maltese
9%
Labrador
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Beagle
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Pitbull terrier
Snout Boxer
Mouth Maltese
Nose Labrador
Eyes Labrador BK
Color Rottweiler