Squeakers Shiner Litecoin Dog - Mix of French Bulldog, Beagle, Poodle, German Shepard, Corgi, Maltese, Shiba Inu, Pitbull terrier, Labrador and Boxer
Squeakers Shiner
  • Purity 1%
  • Age 11 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

You can call me Squeakers Shiner, everybody else does. I enjoy destroying a nice fresh pair of slippers. I am not above stealing food off humans' plates. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. My favorite place in the world is the dog park. So many smells!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAGACTCAAGCCGAACCGTACGATCCCCAAAC
C
T
A
G
A
C
T
C
A
A
G
C
C
G
A
A
C
C
G
T
A
C
G
A
T
C
C
C
C
A
A
A
C
Genes: DI7O9KE9N5G

Composition

French Bulldog
18%
Beagle
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Maltese
9%
Shiba Inu
9%
Pitbull terrier
9%
Labrador
9%
Boxer
9%

Current Energy

Vitality -42 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Poodle
Legs German Shepard
Front Legs Corgi
Head French Bulldog
Ears Maltese
Snout Shiba Inu
Mouth French Bulldog
Nose Pitbull terrier
Eyes Labrador
Color Boxer

Parents

No Children

Gift