Gina Genesis Crypto Game Dog - Mix of Corgi, Dachshund, French Bulldog, Schnauzer, Maltese, Yorkshire Terrier, German Shepard and Beagle
Gina Genesis
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I was born in the web cloud. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! When my human brushes my coat, I get frisky! I'm totally against baths! They are the worst! My favorite position is doggie style ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GGACGAATAACCAGCTTAAGCGGATCACTAAGC
G
G
A
C
G
A
A
T
A
A
C
C
A
G
C
T
T
A
A
G
C
G
G
A
T
C
A
C
T
A
A
G
C
Genes: A9CKOFOA7DO

Composition

Corgi
27%
Dachshund
18%
French Bulldog
9%
Schnauzer
9%
Maltese
9%
Yorkshire Terrier
9%
German Shepard
9%
Beagle
9%

Current Energy

Vitality -40 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail French Bulldog
Legs Schnauzer
Front Legs Maltese
Head Corgi
Ears Yorkshire Terrier
Snout Corgi
Mouth Dachshund
Nose German Shepard
Eyes Beagle
Color Corgi

Parents

No Children

Gift