Destiny Dylan Bitcoin Dog - Mix of German Shepard, Labrador, Boxer, Rottweiler, Yorkshire Terrier, Pug, Pitbull terrier, Maltese, Corgi and Grey Wolf
Destiny Dylan
  • Purity 3%
  • Age 5 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

How YOU doin'? Destiny Dylan here. I live in cyberspace where you can turn me on. I am not above stealing food off humans' plates. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAAACCACTTAGAATCCACCTCATCAAGCCCC
C
C
A
A
A
C
C
A
C
T
T
A
G
A
A
T
C
C
A
C
C
T
C
A
T
C
A
A
G
C
C
C
C
Genes: 5GHF2NK77OL

Composition

German Shepard
18%
Labrador
9%
Boxer
9%
Rottweiler
9%
Yorkshire Terrier
9%
Pug
9%
Pitbull terrier
9%
Maltese
9%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality -33 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Boxer
Legs Rottweiler
Front Legs Yorkshire Terrier
Head Pug
Ears Pitbull terrier
Snout Maltese
Mouth German Shepard
Nose German Shepard
Eyes Corgi
Color Grey Wolf

Parents

No Children

Gift