Bungee Bit Bitcoin Dog - Mix of Pug, German Shepard, Schnauzer, Boxer, Beagle, Border Collie, Poodle, Pitbull terrier, Golder Retriever and St. Bernard
Bungee Bit
  • Purity 3%
  • Age 15 months
  • Racing Exp 0
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

TOP 10 Fastest

Bio

I love unconditionally. I believe running along the beach to catch a stick can be nearly orgasmic. I slept with a cat and I liked it. I hate it when I am not the center of attention.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
Rank 6  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAATAAACCTATACGACTCCGAAGAAAGATGA
T
C
A
A
T
A
A
A
C
C
T
A
T
A
C
G
A
C
T
C
C
G
A
A
G
A
A
A
G
A
T
G
A
Genes: 7CGDJIN228B

Composition

Pug
18%
German Shepard
9%
Schnauzer
9%
Boxer
9%
Beagle
9%
Border Collie
9%
Poodle
9%
Pitbull terrier
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Schnauzer
Legs Boxer
Front Legs Beagle
Head Border Collie
Ears Poodle
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Golder Retriever
Color St. Bernard

Parents

No Children

Gift