Ozzie Olivia Bitcoin Dog - Mix of Boxer, Yorkshire Terrier, Poodle, Shiba Inu, Corgi, Dachshund, Border Collie, Grey Wolf and Rottweiler
Ozzie Olivia
  • Purity 3%
  • Age 13 months
  • Racing Exp 0
  • Boxer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Salutations! My name's Ozzie Olivia. Hope you like the smell of wet fur, because I'll jump into any water I see! I like shaking my fur next to humans right after a good swim! Too much steak gives me the runs! I'm not into dog collars, unless you're into S & M.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GACGTAAACAGCGGATTAAACTACCCCTTACAC
G
A
C
G
T
A
A
A
C
A
G
C
G
G
A
T
T
A
A
A
C
T
A
C
C
C
C
T
T
A
C
A
C
Genes: IEGOAFGJLFH

Composition

Boxer
18%
Yorkshire Terrier
18%
Poodle
9%
Shiba Inu
9%
Corgi
9%
Dachshund
9%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Boxer
Front Legs Corgi
Head Dachshund
Ears Yorkshire Terrier
Snout Boxer
Mouth Border Collie
Nose Grey Wolf
Eyes Yorkshire Terrier
Color Rottweiler

Parents

No Children

Gift