Zack Zeus Virtual Crypto Game Dog - Mix of Border Collie, Corgi, Husky, Rottweiler, Labrador BK, Beagle, Golder Retriever, German Shepard, Grey Wolf, Schnauzer and St. Bernard
Zack Zeus
  • Purity 0%
  • Age 5 months
  • Racing Exp 0
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Wassup? Yo, call me Zack Zeus. Those flying monkeys in the Wizard of Oz still scare me! Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGCACACACGCACTAAGATCACCCATATGA
T
A
C
A
G
C
A
C
A
C
A
C
G
C
A
C
T
A
A
G
A
T
C
A
C
C
C
A
T
A
T
G
A
Genes: JO4H6D87LCB

Composition

Border Collie
9%
Corgi
9%
Husky
9%
Rottweiler
9%
Labrador BK
9%
Beagle
9%
Golder Retriever
9%
German Shepard
9%
Grey Wolf
9%
Schnauzer
9%
St. Bernard
9%

Current Energy

Vitality -29 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Husky
Front Legs Rottweiler
Head Labrador BK
Ears Beagle
Snout Golder Retriever
Mouth German Shepard
Nose Grey Wolf
Eyes Schnauzer
Color St. Bernard

Parents

No Children

Gift