Marcy Marcellini Litecoin Dog - Mix of Boxer, Border Collie, French Bulldog, Grey Wolf, Beagle, Rottweiler, Corgi, Labrador BK and Schnauzer
Marcy Marcellini
  • Purity 4%
  • Age 13 months
  • Racing Exp 0
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

How do you do? I'm Marcy Marcellini. I'm having some new data architecture built for me, then I'd like to have you over to my place. I'm going kill that damn Nyan Cat if I can catch it. If you are looking for a pooch who's in touch with feelings, here I am.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACCGACCCCTAAACCACAGCAACGCAAACATA
T
A
C
C
G
A
C
C
C
C
T
A
A
A
C
C
A
C
A
G
C
A
A
C
G
C
A
A
A
C
A
T
A
Genes: J9LDGHOG6GC

Composition

Boxer
27%
Border Collie
9%
French Bulldog
9%
Grey Wolf
9%
Beagle
9%
Rottweiler
9%
Corgi
9%
Labrador BK
9%
Schnauzer
9%

Current Energy

Vitality -26 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail French Bulldog
Legs Grey Wolf
Front Legs Beagle
Head Boxer
Ears Rottweiler
Snout Corgi
Mouth Boxer
Nose Labrador BK
Eyes Boxer
Color Schnauzer

Parents

No Children

Gift