Sonny Sydney Digital Cryptocurrency Dog - Mix of Corgi, Grey Wolf, Labrador and Labrador BK
Sonny Sydney
  • Purity 39%
  • Age 9 months
  • Racing Exp 0
  • Corgi 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Rolling around on the carpet after a bath is my favorite way to dry. I'm into recreational spankings and a little 'ruff' play. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I love it when you show a little teeth.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCCCCAGCAGCAGCAGCAGCAGCCCAGCACCC
C
C
C
C
C
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
C
A
G
C
A
C
C
C
Genes: LLOOOOOO56L

Composition

Corgi
55%
Grey Wolf
27%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -35 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Corgi
Mouth Corgi
Nose Labrador
Eyes Labrador BK
Color Grey Wolf

Parents

No Children

Gift